Skip to main content

Table 1 Primer sequences of target genes

From: Mitochondrial dependent pathway is involved in the protective effects of carboxymethylated chitosan on nitric oxide-induced apoptosis in chondrocytes

GenePrimerSequenceProduct size (bp)
Bcl-2ForwardTACGAGTGGGATACTGGAGA165
ReverseTCAGGCTGGAAGGAGAAGT
BaxForwardGTTACAGGGTTTCATCCAGG175
ReverseCGTGTCCACGTCAGCAATAC
Cyt cForwardAAATGGGTGATGTTGAAGCT139
ReverseTTGGTCCAGTCTTATGCGGCT
Caspase-3ForwardCTGGACTGCGGTATTGAGTG156
ReverseGGGTGCGGTAGAGTAAGCG
GAPDHForwardTGTCTCCTGCGACTTCAACAG256
ReverseGAGGCCATGTAGGCCATGAG