Skip to main content

Table 1 Primer sequences used for qRT-PCR analysis

From: Effective fraction of Bletilla striata reduces the inflammatory cytokine production induced by water and organic extracts of airborne fine particulate matter (PM2.5) in vitro

Gene NamePrimer Sequence (5′ - > 3′)
GAPDHFoward CATCACTGCCACCCAGAAGACT
 Reverse GACACATTGGGGGTAGGAACAC
TNF-αFoward CGAGTGACAAGCCTGTAGCCC
 Reverse GGGCAGCCTTGTCCCTTGA
IL-6Foward AGTTGCCTTCTTGGGACTGA
 Reverse TTCTGCAAGTGCATCATCGT