Skip to main content

Table 1 Primers used for gene expression analyses. F, forward primer; R, reverse primer

From: The protective effect of Phellinus linteus decoction on podocyte injury in the kidney of FSGS rats

Primer Name Sequence (5′ to 3′) Application
Rat-nephrin-F GTTGGTGGTCTTCTGCTGCTCTC Real-time RT-PCR
Rat-nephrin-R CTTCTGCTGTGCTAACCGTGGAG Real-time RT-PCR
Rat-podocin-F CCAGCAGCCACGGTAGTGAATG Real-time RT-PCR
Rat-podocin-R CCTCTGGTCGCTCGCTCTCC Real-time RT-PCR
Rat-GAPDH-F ACCACAGTCCATGCCATCAC Real-time RT-PCR
Rat-GAPDH-R TCCACCACCCTGTTGCTGTA Real-time RT-PCR