Skip to main content

Table 1 Primer sequences

From: Curcumin ameliorates peritoneal fibrosis via inhibition of transforming growth factor-activated kinase 1 (TAK1) pathway in a rat model of peritoneal dialysis

Genes Forward primer Reverse primer
TGF-β1 (168 bp) AGGGCTACCATGCCAACTTC CCACGTAGTAGACGATGGGC
CTGF (100 bp) TAGCTGCCTACCGACTGGAA GTCTTAGAACAGGCGCTCCA
α-SMA (177 bp)
TAK1 (190 bp)
GGAGCATCCGACCTTGCTAA
CCATCCCAATGGCGTATCTTACA
CCATCTCCAGAGTCCAGCAC
TCATCCTGGTCCAATTCTGCAA
JNK (161 bp) CGGAACACCTTGTCCTGAAT TCGCCTGACTGGCTTTAAGT
p38 (206 bp) CCGAGCGATACCAGAAC CACATCCAACAGACCAATC
GAPDH (253 bp) ACAGCAACAGGGTGGTGGAC TTTGAGGGTGCAGCGAACTT
\