Skip to main content

Table 1 Sequence of primers, which were used for Real-Time RT-PCR

From: Therapeutic effects of hydro-alcoholic extract of Achillea wilhelmsii C. Koch on indomethacin-induced gastric ulcer in rats: a proteomic and metabolomic approach

Gene name Primer sequence
Heat shock protein beta-1 F: ATCACTGGCAAGCACGAAGA
  1. F forward, R reverse