Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 RT-PCR primer sequence

From: Velvet antler polypeptide partially rescue facet joint osteoarthritis-like phenotype in adult β-catenin conditional activation mice

GeneSequence
GAPDH FGACATGCCGCCTGGAGAAAC
GAPDH RAGCCCAGGATGCCCTTTAGT
mmp13 FGCAGCTCCAAAGGCTACAA
mmp13 RCATCATCTGGGAGCATGAAA
Adamts4 FGGCAGATGACAAGATGGCAGCATT
Adamts4 RAGACGAGTCACCACCAAGTTGACA
Adamts5 FCCAAATGCACTTCAGCCACGATCA
Adamts5 RAATGTCAAGTTGCACTGCTGGGTG