Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 The primer pairs used in the qPCR assay and amplicon sizes

From: The effects of Centella asiatica (L.) Urban on neural differentiation of human mesenchymal stem cells in vitro

Gene Primer Sequences Product size (bp)
GAPDH Forward 5′- AGCCTCAAGATCATCAGCAATGCC-3′
Reverse 5′- TGGACTGTGGTCATGAGTCCTTCC-3’
110
S100β Forward 5’- GGAAGGGGTGAGACAAGGA-3′
Reverse 5′- GGTGGAAAACGTCGATGAG-3’
73
p75 NGFR Forward 5’- AACAAGACCTCATAGCCAGCACGG −3′
Reverse 5′- AGCTGTTCCACCTCTTGAAGGC-3’
174
MBP Forward 5’-CTTCAAGAACATTGTGACGCCTCG-3′
Reverse 5′- GTGAGCCGATTTATAGTCGGACG-3’
148
GFAP Forward 5’-ACCTGCAGATTCGAGAAACCAGC-3′
Reverse 5′-ACATCCTTGTGCTCCTGCTTGG-3’
136
  1. GAPDH Glyceraldehyde 3-phosphate dehydrogenase, p75 NGFR Low-affinity nerve growth factor receptor, MBP Myelin binding protein, GFAP Glial fibrillary acidic protein, bp Base pair