Skip to main content

Table 2 Sequences of the primers used for PCR

From: Qianggan extract improved nonalcoholic steatohepatitis by modulating lncRNA/circRNA immune ceRNA networks

Genes Forward primer Reverse primer
Cdc14a TGCACTACACCTCTTTCGACC AGGAGGGTTTGAGCCAGACA
Cnr2 ATGGCCGTGCTCTATATTATCCT ATGGTCACACTGCCGATCTTC
Cd28 CTGTTCTTGGCTCTCAACTTCTT GCTGACCTCGTTGCTATCTACC
Il18r1 ACTACTCCTGCGTGTTTTCTGTC CATCCTTTCCTAGTTCTACACCAAC
Klrc1 CTCGCAGCTCCATTTCAGTC CAATTAAGACAAAACAGATGAGGC
Ncr1 ATGCTGCCAACACTCACTG ATGATGGGTTTCGGGAGAGTC
Ccl8 TCTACGCAGTGCTTCTTTGCC AAGGGGGATCTTCAGCTTTAGTA
Rian GGTGCTGCCTCAGTCTTT TCCAGGATTGATTGTGCT
Foxd2os ATCGGTAGTGGAAATCTGTAAG TCAAAGCGACTGTATTAGGC
Snhg1 TCATGTTGTCACAGCACC GCCCTTTACACTTTGGAG
Circ_0007379 AGACTGCCAGCCCCTCATC GGGAAGCACTCTGGATGTTAGG
Circ_0004572 CATCAATGAAGTCAAGCCTACAGAG CATGGACCTCGTACCCTTTCTC
GAPDH GTGCCGCCTGGAGAAACC GGTGGAAGAGTGGGAGTTGC