Skip to main content

Table 1 Primers for qRT-PCR

From: Effect of Osteoking on the osteogenic and adipogenic differentiation potential of rat bone marrow mesenchymal stem cells in vitro

Target gene Primer(5′-3′) GenBank Accession
PPARγ F:5′- ATGACAGACCTCAGGCAGATTG − 3′ XM_006237009
R:5′- GTCAGCGACTGGGACTTTTCT − 3′
PLIN1 F:5′- ATGAGGAGGAAGAAGAAGAAGAGTC -3′ XM_008759499
R:5′- TCAGGGCATCGGATAGGGA − 3′
OSX F:5′- GTTCACCTGTCTGCTCTGCT − 3’ XM_006242390
R:5′- TTGGCTTCTTCTTCCCCGAC -3’
ALP F:5′- CCCACAAGAGCCCACAATGG − 3’ XM_006239136
R:5′- CGGAAGTGAGGCAGGTAGCAAA − 3’
actin F:5′- ACCGTGAAAAGATGACCCAGAT − 3’ NM_031144
R:5′- CCAGAGGCATACAGGGACAACA − 3’
OCN F:5′- GAGGGCAGTAAGGTGGTGAATAG − 3’ NM_013414.1
R:5′- AAGCCAATGTGGTCCGCTAG-3’
BSPII F:5′- CAACGGCACCAGCACCAA-3’ NM_012587.2
R:5′- TCGTATTCTTCCCCATACTCAACC-3’
COL2A1 F:5’-TAAAACCCTCAACCCCAAAACA-3’ NM_012929.1
R:5′- ATCAGGTCAGGTCAGCCATTCA-3’