Skip to main content

Table 3 Primers used for qRT-PCR analysis

From: The protective effect of Er-Xian decoction against myocardial injury in menopausal rat model

Transcript Sequence (5′-3′)
Gapdh F:5’ GCTCTCTGCTCCTCCCTGTTCTA3’
R:5’ TGGTAACCAGGCGTCCGATA3’
Myh7 F:5’TGCTGTTATTGCTGCCATTG3’
R: 5’AGGAGTTATCATTCCGAACTGTC3’
Myl3 F:5’AAGAACAAAGACACGGGCAC3’
R: 5’GTCAGCATTATGGTTGGGAGA3’
Itgb5 F:5’GAAAGCCCATCTCCACACATAC3’
R: 5’CACTGAGCCATTGTAGGATTTGT3’
Ctnna3 F:5’AAGTCCGAAAAGAGAGCAAAGC3’
R: 5’GCAAGAGGCACATGACATCAGT3’
Ttn F:5’CCTGCGGTGGAAGGAGAATC3’
R: 5’GGTTGTCAGGTCGTCCGTGT3’
Actn2 F:5’TTGCGACCAGTGGGATAGATT3’
R: 5’TAGCAACTTCTCGGTTCTCTCC3’
Lef1 F:5’CAAGGTCAGCCTGTTTATCCC3’
R: 5’GGAAGTGTCCCCTGAAAGTGA3’