Skip to main content

Table 1 Primer Sequences Used in This Study

From: Protective effects of Liuweiwuling tablets on carbon tetrachloride-induced hepatic fibrosis in rats

Target gene Forward primer (5′- 3′) Reverse primer (5′- 3′)
Acta2 GAACACGGCATCATCACCAA CAAGGTCGGATGCTCCTCTG
Collagen I CTCCTGGCAAGAACGGAGA CCAGCTGTTCCAGGCAATC
TGF-β1 CCGCAACAACGCAATCTATG AGTTCTACGTGTTGCTCCACAGT
PDGF TCTGCTGCTACCTGCGTCTG AGGCGCTGAAGGTCATCAA
TIMP1 GCCTCTGGCATCCTCTTGTT CCAGGTCCGAGTTGCAGAA
TIMP2 TATTGTGCCCTGGGACACG GTCCATCCAGAGGCACTCATC
GAPDH GCATCCTGCACCACCAACT GCAGTGATGGCATGGACTGT