Skip to main content

Table 1 List of primers used for real-time PCR

From: Antischistosomal and anti-inflammatory activity of garlic and allicin compared with that of praziquantel in vivo

Gene Forward (F) and Reverse (R)
IL-13 F: CGGCAGCATGGTATGGAGTG
R: ATTGCAATTGGAGATGTTGGTCAG
(tTG) Tissue F: GTGAGCCGTGCTATCTGTCCTG
Transglutaminase R: ACTGCCTGCTTGGAACCTGAA
IL-1β F: GTGCTGGCTGGCCCACA
R: GAACACCACTTCTCTCTTCA
IL-6 F: GGTACATCCTCGACGGCATCT
R: GTGAAAGCAGCAAAGAGGCACT
TNF-α F: AACCTCAGATAAGCCCGTCG
R: ACCACCAGCTGGTTGTCTTT
GAPDH F: TGTGTCCGTCGTGGATCTGA
R: TTGCTGTTGAAGTCGCAGGAG