Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers and quantitative PCR conditions to determine expression of murine immunomodulatory cytokines

From: Aqueous extract of Phragmitis rhizoma ameliorates myelotoxicity of docetaxel in vitro and in vivo

Target Forward (5′ → 3′) Reverse (5′ → 3′) GenBank Accession #
 GAPDH TTGATGGCAACAATCTCCAC CGTCCCGTAGACAAAATGGT NM_001001303
 GM-CSF CCGTAGACCCTGCTCGAATA TGCCTGTCACATTGAATGAA NM_009969.4
 IFNγ ATGAACGCTACACACTGCATC CCATCCTTTTGCCAGTTCCTC NM_008337
 IL1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT NM_008361
 IL3 All-in-One™ qPCR primer (MQP029461) NM_010556.4
 IL6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC NM_031168
 IL7 TTCCTCCACTGATCCTTGTTCT AGCAGCTTCCTTTGTATCATCAC X07962.1
 IL12β TGGTTTGCCATCGTTTTGCTG ACAGGTGAGGTTCACTGTTTCT NM_008352
 SCF ATGTTCCCCGCTCTCTTTGG GTGTGGCATAAGGGCTCACT NM_013598.2
 TNFα CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG NM_013693
Step Temperature (°C) Time (s) # of cycle
 Activation 95 30 1
 Amplification 95 15 40
60 30
 Melting-curve 65–95 2 s/step 1