Skip to main content

Table 1 Sequences of oligonucleotide primers and details of polymerase chain reactions

From: Xue-fu-Zhu-Yu decoction protects rats against retinal ischemia by downregulation of HIF-1α and VEGF via inhibition of RBP2 and PKM2

mRNA Primers (5’→3’)
F: Forward
R: Reverse
Bases in base pairs Product size Cycles profile
(Temperature and time in seconds)
Cycles number
β-actin F: AGGGAAATCGTGCGTGACAT 694 713 150 95°C / 95°C / 60°C 40
R: GAACCGCTCATTGCCGATAG 824-843   (20s / 3s / 30s)
VEGF F: GCGGGCTGCTGCAATG 1262-1277 268 95°C / 95°C / 60°C 40
R: TGCAACGCGAGTCTGTGTTT 1528-1547   (20s / 3s / 30s)
HIF-1α F: ACAGCTCCCCAGCATTTCAC 2748-2767 90 95°C / 95°C / 60°C 40
R: GGACAAACTCCCTCACCAAAAA 2837-2816   (20s / 3s / 30s)
PKM2 F: TCTACGTGGACGATGGGCT 833-851 403 95°C / 95°C / 60°C 40
R: AGGAAGACCTTCTCTGCCGGA 1215-1235   (20s / 3s / 30s)
RBP2 F: TTGTGGTGACGTTTCCTCGT 2093-2112 213 95°C / 95°C / 60°C 40
R: CAGCCAGCCCCACATCTAAG 2305-2286   (20s / 3s / 30s)