Skip to main content

Table 1 List of the primers used in this study

From: In vitro induction of human embryonal carcinoma differentiation by a crude extract of Rhazya stricta

Primer Sequence Product size (bp)
h-Oct4 F-CCTCACTTCACTGCACTTGTA
R-CAGGTTTTCTTTCCCTAGCT
165
h-Sox2 F- ATGTCCCAGCACTACCAGAG
R- GCACCCCTCCCATTTCCC
141
h-Kf4 F- GGTCGGACCACCTCGCCTTACAC
R- CTCAGTTGGGAACTTGACCA
172
h-Nanog F- TTTGTGGGCCTGAAGAAAACT
R- AGGGCTGTCCTGAATAAGCAG
116
h-β-actin F- AAACTGGAACGGTGAAGGTG
R- AGAGAAGTGGGGTGGCTTTT
171