Skip to main content

Table 1 Real-Time PCR Primers sequences

From: Effects of sesamin on chondroitin sulfate proteoglycan synthesis induced by interleukin-1beta in human chondrocytes

Gene Real-time PCR primer sequence (5′-3′)
ACAN Forward: ACTTCCGCTGGTCAGATGGA
Reverse: TCTCGTGCCAGATCATCACC
XT-1 Forward: GTGGATCCCGTCAATGTCATC
Reverse: GTGTGTGAATTCGGCAGTGG
XT-2 Forward: CGAATCGCCTACATCATGCTGG
Reverse: TAAACGGCCTTGAGGAGACG
CHSY-I Forward: CCCGCCCCAGAAGAAGTC
Reverse: TCTCATAAACCATTCATACTTGTCCAA
ChPF Forward: AGATCCAGGAGTTACAGTGGGAGAT
Reverse: CCGGGCGGGATGGT
IL-1β Forward: AAACAGATGAAGTGCTCCTTCCAGG
Reverse: TGGAGAACACCACTTGTTGCTCCA
MMP-13 Forward: TTGAGCTGGACTCATTGTCG
Reverse: GAGCCTCTCAGTCATGGAG
ADAMTs-4 Forward: CCCCAGACCCCGAAGAGCCA
Reverse: CCCGCTGCCAGGCACAGAAG
DEC Forward: CCTGATGACCGCGACTTCGAG
Reverse: TTTGGCACTTTGTCCAGACCC
GADPH Forward: GAAGGTGAAGGTCGGAGTC
Reverse: GAAGATGGTGATGGGATTTC