Skip to main content

Table 2 Primer sequences

From: HVC1 ameliorates hyperlipidemia and inflammation in LDLR−/− mice

Gene Primer sequences 5′-3’
PPARγ forward TTGGAATCAGCTCTGTGCA
  reverse CCATTGGGTCAGCTCTTGTG
PPARα forward ACGATGCTGTCCTCCTTGATG
  reverse GTGTGATAAAGCCATTGCCGT
PPARδ forward AGATGGTGGCAGAGCTATGACC
  reverse TCTCCTCCTGTGGCTGTTCC
HMG-CR forward TGGCAGAAAGAGGGAAAGG
  reverse CGCCTTTGTTTTCTGGTTGA
apoB forward TCACCATTTGCCCTCAACCTAA
  reverse GAAGGCTCTTTGGAAGTGTAAAC
LPL forward TGGAGAAGCCATCCGTGTG
  reverse TCATGCGAGCACTTCACCAG
SREBP-2 forward TGCTGGATGACGCAAAGGTC
  reverse AAAGGAGAGGCCCAGGAAGG
LXR forward TCCTACACGAGGATCAAGCG
  reverse AGTCGCAATGCAAAGACCTG
TNFα forward CCAGTGTGGGAAGCTGTCTT
  reverse AAGCAAAAGAGGAGGCAACA
IL-6 forward CTGCAAGAGACTTCCATCCAGTT
  reverse GAAGTAGGGAAGGCCGTGG
IL-1β forward GATCCACACTCTCCAGCTGCA
  reverse CAACCAACAAGTGATATTCTCCATG
GAPDH forward GACGGCCGCATCTTCTTGT
  reverse CACACCGACCTTCACCATTTT