Skip to main content

Table 1 Sequences of primers used in the RT-PCR

From: Antiangiogenic effects of oridonin

Gene name Sequence of primers
VEGFA Forward CAGCTGTCAAGAGTGCCTACATAC
Reverse CATCAGGGTACTCCTGCTGAATTTC
VEGFR2 Forward TCACATGGTTTGGTAGAGGGATCTC
Reverse GTGCAGTTGATCCTCTGCAAATGAG
VEGFR3 Forward TCTGTCGGATTTGGATTGGGA
Reverse TTGGTGTTGTCAAGGGTGGG
TP53 Forward CTTGCCCCGTTCAAATGGTG
Reverse TAGATGGCAGTGGCTCGAAC
β-Actin Forward CGAGCAGGAGATGGGAACC
Reverse CAACGGAAACGCTCATTGC