Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequence used in RT-PCR

From: Allium hookeri root extract exerts anti-inflammatory effects by nuclear factor-κB down-regulation in lipopolysaccharide-induced RAW264.7 cells

Genes Forward primer (5’–3’) Reverse primer (5’–3’)
GAPDH CGTAGACAAATGGTGAAGGT AATGAAGGGGTCGTTGATG
iNOS GCCAAGCCCTCACCTACTTC CCAGAAACTTCGGAAGGGAG
COX-2 TTCTTTGCCCAGCACTTCAC GGTTGAAAAGGAGCTCTGGG