Skip to main content

Table 1 Primer sequence of Real-time PCR related

From: Effects of aqueous extracts of Taraxacum Officinale on expression of tumor necrosis factor-alpha and intracellular adhesion molecule 1 in LPS-stimulated RMMVECs

Gene Primer sequences Fragment
TNF-α F TGACCCCCATTACTCTGACC 152 bp
TNF-α R TTCAGCGTCTCGTGTGTTTC
ICAM-1 F AACGACGCTTCTTTTGCTCTG 136 bp
ICAM-1 R TCTTGCCAGGTCCAGTTCC
β-actin F GCTACAGCTTCACCACCACA 94 bp
β-actin R GCCATCTCTTGCTCGAAGTC