Skip to main content

Table 1 Primer pair and their information for quantitative real-time PCR

From: Effects of the Ayurved Siriraj Wattana recipe on functional and phenotypic characterization of cytokine-induced killer cells and dendritic cells in vitro

Genes Oligonucleotides (5′ → 3′) Size (bp) Annealing (°C)
GAPDH Forward: GAAATCCCATCACCATCTTCC 124 60
Reverse: AAATGAGCCCCAGCCTTCTC
IDO Forward: AGTCCGTGAGTTTGTCCTTTCAA 68 60
Reverse: TTTCACACAGGCGTCATAAGCT
IFNγ Forward: GTGTGGAGACCATCAAGGAAGAC 80 60
Reverse: CAGCTTTTCGAAGTCATCTCGTTT
IL-4 Forward: AACAGCCTCACAGAGCAGAAGAC 101 60
Reverse: GCCCTGCAGAAGGTTTCCTT
IL-6 Forward: GCTGCAGGCACAGAACCA 68 60
Reverse: ACTCCTTAAAGCTGCGCAGAA
IL-10 Forward: CTGGGTTGCCAAGCCTTGT 100 60
Reverse: AGTTCACATGCGCCTTGATG
IL-12 Forward: GCAAAACCCTGACCATCCAA 100 60
Reverse: TGAAGCAGCAGGAGCGAAT
IL-17 Forward: ACCTGTGTCACCCCGATTGT 90 58
Reverse: GGGTCGGCTCTCCATAGTCTAA
GATA3 Forward: ACTACGGAAACTCGGTCAGG 100 60
Reverse: CAGGGTAGGGATCCATGAAG
STAT1 Forward: GTGGCGGAACCCAGGAAT 97 60
Reverse: TGACAGAAGAAAACTGCCAACTCA
STAT3 Forward: ACCAAGCGAGGACTGAGCAT 90 58
Reverse: TGTGATCTGACACCCTGAATAATTC
STAT4 Forward: TTCCTTCTGTTTTTATCCCCATCT 128 60
Reverse: TGTTGTGGGACTCAGGTTTTCTC
STAT5A Forward: CACGCAGGACACAGAGAATGA 80 58
Reverse: TCAGGCTCTCCTGGTACTGGAT
STAT5B Forward: GGTCACGCAGGACACAGAGAA 110 58
Reverse: CCAGCGGGCCAAACTG
STAT6 Forward: CTTTTGGCAGTGGTTTGATGGT 96 60
Reverse: TGTTTGCTGATGAAGCCAATG
T-bet Forward: AGGATTCCGGGAGAACTTTGA 123 60
Reverse: TACTGGTTGGGTAGGAGAGGAGAGTA
RORC Forward: CCACAGAGACATCACCGAGCC 114 60
Reverse: GTGGATCCCAGATGACTTGTCC
\