Skip to main content

Table 1 Primer Sequences

From: Ganoderma lucidum beta 1,3/1,6 glucan as an immunomodulator in inflammation induced by a high-cholesterol diet

Gene Primer Sequences (5′ to 3′) GeneBank No.
B-actin (Reference gene) F: ACCACACCTTCTACAATGAG BC138614.1
R: ACGACCAGAGGCATACAG
Poly-Ig receptor F: AGGAGGTGAGTAGTATAGAAG NM_011082.3
R: GGAAGTTGATGAGGTTGG