Table 1 Primers used for the RT-PCR analysis of TRPV1, P2X3, and GAPDH
From: Effect of SQW on the bladder function of mice lacking TRPV1
cDNA/product sizes | Sequence (5′-3′) | Amplified length (bp) |
|---|---|---|
GAPDH | Forward primers: ggtgaaggtcggtgtgaacg | 233 |
Reverse primers: ctcgctcctggaagatggtg | ||
TRPV1 | Forward primers: gtttacctcgtccaccctga | 106 |
Reverse primers: agagagccatcaccatcctg | ||
P2X3 | Forward primers: tctccagcagagacatcagca | 163 |
Reverse primers: gggagcatcttggtgaactcag |