Skip to main content

Table 1 Primer sequences and annealing temperature of each gene (Table 1 should be listed at the end of 2.9 RNA isolation and qRT-PCR, on the Page 8)

From: Mechanisms of Heshouwuyin in regulating apoptosis of testicular cells in aging rats through mitochondrial pathway

Gene Primer sequences Annealing Product
Tm (°C) size (bp)
Ccng1 F:CCTTCCAATTTCTGCAGCTC 60 °C 281
R:CTTGGAAACAAGCTCTTGCC
GHR F:ATCTTTGGCGGGTGTTCTTA 60 °C 78
R:TGTTGGCTATCTCGTAGTGGA
Cabin1 F:AGTCCAGCAGAGCCAAGTCC 60 °C 313
R:TGAACCCGTCATACGTCCAT
Capn8 F:ACGCTGTCTACCAGATTCCC 64 °C 342
R:TGCCCACAAACTCCTCAAAC
AK1 F:GTGGACGATAACGAGGAG 60 °C 166
R:TCAGGGAGTCAAGATAGGTG
Cybrd1 F:CTTCGTACCATTCATTCCCACC 58 °C 171
R:CCATTCCGTCTGCGTTGC
Kdm2b F:TGCCGAGATGAAATACCC 60 °C 170
R:CATACAGAGCCAAGTTGTGC
Glrx3 F:AGCACCCAAGTTAGAGGA 60 °C 292
R:TAGCAATTCACCGTTGTC
ADAM5 F:CCGTTGAAATCTGGTCG 55 °C 107
R:AATGTGCTGCGGTCTAT
BAX F:GCGATGAACTGGACAACAACAT 62 °C 153
R:TAGCAAAGTAGAAAAGGGCAACC
caspase-3 F:GACTGCGGTATTGAGACAGA 60 °C 209
R:CGAGTGAGGATGTGCATGAA
DR6 F:CAGACCATGAACGAGCCT 60 °C 142
R:GTATCTTCCATCAGCCCAC
14-3-3σ R:TAGCTGGTGTAGCCCCACTT 55 °C 95
F:CATGGACATCAGCAAGAAGGA
GSY2 F:CCTCGATGGCTGTGATTTCTGACAC 60 °C 172
R:CTTGGGCGTTATCTCTGTGCAGCAA
SOCS3 F:CTGGACCCATTCGGGAGTTC 62 °C 105
R:AACTGGGAGCTACCGACCATTG
β-actin F:GACGTTGACATCCGTAAAGACC 60 °C 115
R:TGCTAGGAGCCAGGGCAGTA