Skip to main content

Table 1 Primers used in this study

From: The role of kaempferol-induced autophagy on differentiation and mineralization of osteoblastic MC3T3-E1 cells

Gene Sense (5′-3′) Antisense (5′-3′)
RUNX-2 CCCAGCCACCTTTACCTACA TATGGAGTGCTGCTGGTCTG
Osterix GCAAGAGGTTCACTCGCTCT GTGGTCGCTTCTGGTAAAGC
LC3 TTCTTCCTCCTGGTGAATGG ATTGCTGTCCCGAATGTCTC
SQSTM1/p62 GAAGCTGCCCTATACCCACA GGTCTGTAGGAGCCTGGTGA
GAPDH AACTTTGGCATTGTGGAAGG GGATGCAGGGATGATGTTCT