Skip to main content

Table 2 Primers for human wild-type AR mRNA expression vector and mutant AR-Asn160 expression vector

From: Investigation of synergistic mechanism and identification of interaction site of aldose reductase with the combination of gigantol and syringic acid for prevention of diabetic cataract

Primer Sequence
wild-type AR HindIIIF:5’ CCCAAGCTTATGGCAAGCCGTCTCCTG 3’
XhoIR:5’ CCGCTCGAGTCAAAACTCTTCATGGAAGGG 3’
mutant AR-Asn160 HindIIIF:5’ CCCATCCTGGGGTTGGGTACCGCTAAGGGTGGTGGTTCTGGAGGTG3’
XhoIR:5’ CTGCCCTGGAGGGGACTTAGCGGTACCTCCCTGGCTATTATCTGAGCTT 3’