Skip to main content

Table 1 Gene name and sequences of primers used in the multiplex panel

From: Clausenidin induces caspase-dependent apoptosis in colon cancer

Gene Name Forward sequence Reverse sequence
Bax AGGTGACACTATAGAATAGCAAACTGGTGCTCAA GTACGACTCACTATAGGGAAACCACCCTGGTCTTG
Bcl-2 AGGTGACACTATAGAATACTGTGGATGACTGAGTACCT GTACGACTCACTATAGGGATCAGAGACAGCCAGGAG
Apaf-1 AGGTGACACTATAGAATACATACTCTTTCACCAGATCA GTACGACTCACTATAGGGAACAAGTTCTGTTTTTGCTTT
Cyt c AGGTGACACTATAGAATAGAGCGAGTTTGGTTGC GTACGACTCACTATAGGGAAAATCTTCTTGCCTTTCTC
Caspase 3 AGGTGACACTATAGAATATGTAGAAGAGTTTCGTGAGT GTACGACTCACTATAGGGAGAGTTTTCAGTGTTCTCCAT
Caspase 9 AGGTGACACTATAGAATAGCTGGTGGAAGAGCTG GTACGACTCACTATAGGGACTCTAAGCAGGAGATGAACA
β-actin AGGTGACACTATAGAATAGATCATTGCTCCTCCTGAGC GTACGACTCACTATAGGGAAAAGCCATGCCAATCTCATC
  1. The β-actin gene was used for normalization. Reverse transcription (RT) and PCR were done according to manufacturer’s instructions; RT reaction was at 480 °C for 1 min; 370 °C for 5 min; 420 °C for 60 min; 950 °C for 5 min; then held at 40 °C, while PCR was as follows: initial denaturation at 950 °C for 10 min, followed by two-step cycles of 940 °C for 30 s and 550 °C for 30 s, ending in a single extension cycle of 680 °C for 1 min. Bax: Bcl-2-associated X protein; Bcl-2: B cell lymphoma 2; Apaf-1: Apoptotic protease activating factor 1; Cyt c: cytochrome complex; Caspase 3: Cysteine aspartic acid protease 3; Caspase 9: Cysteine aspartic acid protease 9