Skip to main content

Table 2 Nucleotide sequences of primers used in real-time RT-PCR

From: Anti-inflammatory effect and action mechanisms of traditional herbal formula Gamisoyo-san in RAW 264.7 macrophages

Gene Forward Reverse Accession no.
iNOS AAGGTCTACGTTCAGGACATC AGAAATAGTCTTCCACCTGCT NM_010927
COX-2 TTCCTCTACATAAGCCAGTGA TCCACATTACATGCTCCTATC NM_011198
GAPDH TGTGTCCGTCGTGGATCTGA CCTGCTTCACCACCTTCTTGA NM_008084