Skip to main content

Table 1 Primer sequences for real time PCR assays

From: Treatment with Rhodiola crenulata root extract ameliorates insulin resistance in fructose-fed rats by modulating sarcolemmal and intracellular fatty acid translocase/CD36 redistribution in skeletal muscle

Gene Accession number Primer Sequences
β-actin NM_031144.2 Forward: ACGGTCAGGTCATCACTATCG
   Reverse: GGCATAGAGGTCTTTACGGATG
Adiponectin NM_144744.3 Forward: CGTTCTCTTCACCTACGACCAGT
   Reverse: ATTGTTGTCCCCTTCCCCATAC
CD36 NM_001109218 Forward: AACCCAGAGGAAGTGGCAAAG
   Reverse: GACAGTGAAGGCTCAAAGATGG
DGAT-1 NM_053437.1 Forward: GGACAAAGACCGGCAGACCA
   Reverse: CAGCATCACCACGCACCAAT
DGAT-2 NM_001012345.1 Forward: CCTGGCAAGAACGCAGTCAC
   Reverse: GAGCCCTCCTCAAAGATCACC
PPAR-γ AB_011365.1 Forward: GCCCTTTGGTGACTTTATGGAG
   Reverse: GCAGCAGGTTGTCTTGGATGT
  1. Sequences: 5’ to 3’