Skip to main content

Table 2 Primers designed for real-time PCR

From: Wound healing potential of lavender oil by acceleration of granulation and wound contraction through induction of TGF-β in a rat model

Name Sense primer (5′-3′) Antisense primer (5′-3′)
rat type I collagen a2 GCTTTGTGGATACGCGAACTC CCAGCATTGGCATGTTGCT
rat type III collagen a1 TGATGGGATCCAATGAGGGAG GAGTCTCATGGCCTTGCGTGTTT
rat GAPDH ATGGCACAGTCAAGGCTGAGA CGCTCCTG GAAGATGGTGAT