Skip to main content

Advertisement

Table 1 Oligonucleotide sequences used in this study

From: Rhodiola crenulata extract regulates hepatic glycogen and lipid metabolism via activation of the AMPK pathway

HepG2 cells Nucleotide sequences (5′-3′) Reference
SREBP1c sense TCAGCGAGGCGGCTTTGGAGCAG [35] (Suh HN, 2008)
SREBP1c antisense CATGTCTTCGATGTCGGTCAG
FAS sense CGGTACGCGACGGCTGCCTG  
FAS antisense GCTGCTCCACGAACTCAAACACCG
GAPDH sense TGGTATCGTGGAAGGACTCA [36]
GAPDH antisense AGTGGGTGTCGCTGTTGAAG
Rat liver
SREBP1c sense
SREBP1c antisense
FAS sense
AGGACCCAAGGTGACACCTG
GCCGGACGGGTACATCTTT
AACTGAACGGCATTACTCGGTC
 
FAS antisense GTGTCCCATGTTGGATTTGGT
GAPDH sense AACGGCACAGTCAAGGCTGA [37]
GAPDH antisense ACGCCAGTAGACTCCACGACAT