Skip to main content

Table 1 Description of primers used in qRT-PCR

From: Gelam honey potentiates ex vivo corneal keratocytes proliferation with desirable phenotype expression

Gene Sequence 5’ → 3’ NIH Genbank access no. PCR product size (bp)
GAPDH F: caacgaatttggctacagca NM_001082253 186
R: aaactgtgaagaggggcaga
ALDH F: gagtggcatgattcagtgagc AY503694 186
R: gagtagtcgtcccctcttgga
Vimentin F: tgcaggaagagattgccttt AY465353 117
R: tgaggtcaggcttggagaca
α-SMA F: tcgacatcaggaaggacctct X60732 206
R: catctgctgaaaggtggacag