Skip to main content

Table 1 Quantitative real-time PCR primers and probes

From: Studies on the purification of polypeptide from sika antler plate and activities of antitumor

TERT Tert -Forward:5- CAACAGAAAGTCATCAACAAAACG–3
  Tert -Reverse:5- GCTCCAGCCTATCCACCCT–3
  Tert -Taqman-MGB-Probe:5- AAGCAACCCATCCCG–3
β-actin (mBA) mBA-MGB-Forward: GACAGGATGCAGAAGGAGATTACTG
  mBA-MGB-Reverse: GCTGATCCACATCTGCTGGAA
  mBA-MGB-FAM: FAGATCAAGATCATTGCTCCP