Skip to main content

Table 1 Primers sequences for reverse transcription–polymerase chain reaction (RT–PCR)

From: Radix Scrophulariae extracts (harpagoside) suppresses hypoxia-induced microglial activation and neurotoxicity

Gene name Primer Product (bp)
(Gene bank) (F:sense primer/R: antisense primer)
IL-1β F: 5′- GTGTGTGACGTTCCCATTAGA -3′ 101
(NM8361) R: 5′- AGGTGGAGAGCTTTCAGCTCA -3′
IL-6 F: 5′- CAAGTCGGAGGCTTAAAC -3′ 101
(X54542) R: 5′- AAGTGCATCATCGTTGTTCAT -3′
TNF-α F: 5′- TCTCTACCTTGTTGCCTCCTCTTTT -3′ 150
(NM013693.1) R: 5′- TGTAGGGCAATTACAGTCACGG -3′
COX-2 F: 5′- CTGACCCCCAAGGCTCCA -3′ 94
(NM011198) R: 5′- CCAGGTCCTCGCTTATGA -3′
iNOS F: 5′- AACATCAGGTCGGCCATCA -3′ 94
(NM010927) R: 5′- CGTACCGGATGAGCTGTCA -3′
β-miroglobulin F: 5′-TTCAGTGTGAGCCAGGATATAGAAA-3′ 153
(NM009735.3) R: 5′-GAAGCCGAACATACTGAACTGCT-3′