Skip to main content

Table 1 Amplification primers used in real-time PCR

From: Effect of Ginkgo biloba extract on experimental cardiac remodeling

Gene Primer sequence (5′ to 3′) Gene sequence number
TGF-β1 F1 GCTCCTGTGACAGCAGGGAT NM_000660.5
TGF-β1 R1 GGCAGAAGTTGGCATGGTAG
MMP-2 F1 GTGCCAAGGTGGAAATCAGAG NM_031054.2
MMP-2 R1 AAGGTTGAAGGAAACGAGCGA
MMP-9 F1 GTCTTCCCCTTCGTCTTCCT NM_031055.1
MMP-9 R1 ACCCCACTTCTTGTCAGCGT