Skip to main content

Table 1 Primers used in quantitative RT-PCR analysis of proteins identified by 2DE

From: Gamma-tocotrienol treatment increased peroxiredoxin-4 expression in HepG2 liver cancer cell line

Protein Accession number Primer sequence 5′–3′
PRDX4 NM_006406.1 F: ccacttctacgcgggtggacaa
R: cagtagggcgctggcttggaaa