Skip to main content

Table 2 Sequences of gene specific primers

From: An evaluation of the anti-angiogenic effect of the Korean medicinal formula “Sa-mi-yeon-geon-tang” in vitro and in ovo

Target Forward (5′ → 3′) Reverse (5′ → 3′) Amplicon (bp)
MMP2 ATGCCGCCTTTAACTGGAG GGGAAGCCAGGATCCATTTT 103
GAPDH AAGGCTGAGAACGGGAAG GGACTCCACGACGTACTC 114