Skip to main content

Table 1 Primers sequences

From: Vitamin E attenuates neurotoxicity induced by deltamethrin in rats

Gene Direction Primer sequence Product size Reference
CYP2E1 Forward TCCAGGTTTGCACCAGACTCT 76 bp [26]
Reverse TCCTCGCTCCTCCTGAGAAG
TP53 Exon 7 Forward GTG GTA CCG TAT GAG CCA CC 157 bp [27]
Reverse CAA CCT GGC ACA CAG CTT CC
COX2 Forward AAA GCC TCGTCCAGATGCTA 249 bp [26]
Reverse ATGGTGGCTGTCTTGGTAGG
GAPDH Forward ACCACAGTCCATGCCATCAC 460 bp [28]
Reverse TCCACCACCCTGTTG CTGTA