Skip to main content

Table 1 PCR conditions for rat antioxidants, cytokines and acute phase proteins genes

From: Immunohistochemical and molecular study on the protective effect of curcumin against hepatic toxicity induced by paracetamol in Wistar rats

Gene Forward primer (5′-3′) Reverse primer (5′-3′) PCR cycles and conditions
GST (575 bp) GCTGGAGTGGAGTTTGAAGAA GTCCTGACCACGTCAACATAG 35 cycles, 55°C 1 min
GPx (406 bp) AAGGTGCTGCTCATTGAGAATG CGTCTGGACCTACCAGGAACTT 40 cycles 57°C 1 min
SOD (410 bp) AGGATTAACTGAAGGCGAGCAT TCTACAGTTAGCAGGCCAGCAG 35 cycles, 55°C 1 min
Catalase (652 bp) GCGAATGGAGAGGCAGTGTAC GAGTGACGTTGTCTTCATTAGCACTG 35 cycles, 55.5°C 1 min
IL-1β (218 bp) ATGGCAACCGTACCTGAACCCA GCTCGAAAATGTCCCAGGAA 30 cycles, 61°C 1 min
TNF-α (256 bp) CCACCACGCTCTTCTGTCTAC ACCACCAGTTGGTTGTCTTTG 30 cycles, 58°C 1 min
IL-8 (460 bp) CTCCAGCCACACTCCAACAGA CACCCTAACACAAAACAGAT 35 cycles, 56°C 1 min
IL-10 (320bp) GGAGTGAAGACCAAAGG TCTCCCAGGGAATTCAAATG 30 cycles, 57°C 1 min
α2 –macroglobulin (325 bp) GCTCCTGTCTGTTTCCTTAGTT ATTGGCCTTTCGTGGTTTAG 30 cycles, 56°C 1 min
α1-glycoprotein (230 bp) GCTTTCCTCCTGACAACGCTG GGCTTTTTGTTGTTTGCTTCTATTTC 30 cycles, 55°C 1 min
GAPDH (309 bp) AGATCCACAACGGATACATT TCCCTCAAGATTGTCAGCAA 25 cycles, 52°C 1 min