Skip to main content

Table 1 Primers used for qRT-PCR

From: Cytotoxicity of Eupatorium cannabinum L. ethanolic extract against colon cancer cells and interactions with Bisphenol A and Doxorubicin

Sequence Accession no. Forward primer (5’ → 3’) Reverse primer (5´ → 3´)
p21[31] NM_000380 CTGGAGACTCTCAGGGTCGAA CCAGGACTGCAGGCTTCCT
AURKA[27] NM_003600 GCTGGAGAGCTTAAAATTGCAG TTTTGTAGGTCTCTTGGTATGTG
FOS[31] NM_005252 AGGAGAATCCGAAGGGAAAG CAAGGGAAGCCACAGACATC
bcl-xl[31] NM_001191.2 TTACCTGAATGACCACCTA ATTTCCGACTGAAGAGTGA
NCL[31] NM_005381 CCTTCTGAGGACATTCCAAGACA ACGGTATTGCCCTTGAAATGTT
GAPDH[27] NM_002046 GAGTCAACGGATTTGGTCGTA GCAGAGATGATGACCCTTTTG
β-actin[31] NM_001101 GGTCATCTTCTCGCGGTTGGCCTTGGGGT CCCCAGGCACCAGGGCGTGAT