Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequences of primers used in real-time PCR

From: An ethyl acetate fraction derived from Houttuynia cordata extract inhibits the production of inflammatory markers by suppressing NF-кB and MAPK activation in lipopolysaccharide-stimulated RAW 264.7 macrophages

Gene Forward Reverse Accession no. Length (bp)
iNOS AAGGTCTACGTTCAGGACATC AGAAATAGTCTTCCACCTGCT NM_010927 187
COX-2 TTCCTCTACATAAGCCAGTGA TCCACATTACATGCTCCTATC NM_011198 200
GAPDH TGTGTCCGTCGTGGATCTGA CCTGCTTCACCACCTTCTTGA NM_008084 77