Skip to main content

Table 1 Primers list for real-time PCR assay

From: Selaginella tamariscina extract suppresses TPA-induced invasion and metastasis through inhibition of MMP-9 in human nasopharyngeal carcinoma HONE-1 cells

Primers used in real-time PCR

Sequence (5’ to 3’)

MMP-9 (Hs00957562_m1)

(FAM)- GGCGCTCATGTACCCTATGT

GAPDH ( Hs99999905_m1)

(FAM)-GGCGCCTGGTCACCAGGGCTGCTTT

Back to article page

BMC Complementary Medicine and Therapies

ISSN: 2662-7671

Contact us