Skip to main content

Table 1 Showing primers and probe used

From: Protective effect of rutin on the antioxidant genes expression in hypercholestrolemic male Westar rat

Gene name Forward primer Reverse primer Probe
Glutathione peroxidase 5’-GGTGTTCCAGTGCGCAGAT-3’ 5’-AGGGCTTCTATATCGGGTTCGA-3’ FAM-CAGCAGGCGCTTTCGCACCA-TAMRA
Glutathione reductase 5’-TGAGCCGCCTGAACAACA-3’ 5’-TTGCGTAGCCGTGGATGAC-3’ FAM-CCAAAACAATTTAACCAAGTCCCACATCGA-TAMRA
Glutathione s transferase -α 5’-AATATGTCCCCCAGACCAAAGA-3’ 5’-GGCAGGCAAGTACCGGTTT-3’ FAM-CGCCTTGGCAAAAGACAGGACCA-TAMRA
Glutamate-cysteine ligase 5’CAGAGTATGGGAGTTACATGATTGAAG-3’ 5’-TGTGTTGAACTCGGACATCGTT-3’ FAM-ACACCTGGCCAGCCGTACGGAG-TAMRA
Paraoxonase-1 5’-TGAGAGCTTCTATGCCACAAATG-3’ 5’-CCATGACAGGCCCAAGTACA-3’ FAM-TTTTGCTGACCCATACTTACGGTCCTGG-TAMRA
Sulfiredoxin-1 5’-AATCCCCAACCCCTGACTTT-3’ 5’-TGAACTGACCAGTGGAGACACAGT-3’ FAM-ACAAGGTTTCTTCAGCCCCGGTGC-TAMRA
GAPDH 5'- TGGCCTCCAAGGAGTAAGAAAC -'3 5'- GGCCTCTCTCTTGCTCTCAGTATC -'3 FAM- CTGGACCACCCAGCCCAGCAA-TAMRA