Skip to main content

Advertisement

Table 1 Primers used for real time-qPCR

From: Sesamin stimulates osteoblast differentiation through p38 and ERK1/2 MAPK signaling pathways

Gene Sequence (5’-3’): Forward (F); Reverse (R) Accession number
ALP F:CATGGCTTTGGGCAGAAGGA NM_001114107.2
R:CTAGCCCCAAAAAGAGTTGCAA
BMP-2 F:ATGGATTCGTGGTGGAAGTC NM_001200.2
R:GTGGAGTTCAGATGTCAGC
Type I Collagen F:CAGCCGCTTCACCTACAGC NM_000088.3
R:TTTTGTATTCAATCACTGTCTTGCC
RANKL F: CACTATTAATGCCACCGAC NM_033012.3
R: GGGTATGAGAACTTGGGATT
Runx2 F: GCCTTCAAGGTGGTAGCCC NM_001024630.2
R: CGTTACCCGCCATGACAGTA
OC F: GAAGCCCAGCGGTGCA NM_199173.2
R: CACTACCTCGCTGCCCTCC
OPG F: CCTCTCATCAGCTGTTGTGTG NM_002546.3
  R: TATCTCAAGGTAGCGCCCTTC  
GAPDH F:GAAGGTGAAGGTCGGAGTC NM_002046.3
  R:GAAGATGGTGATGGGATTTC