Skip to main content

Table 1 The following primer pairs were used

From: Baicalin, a natural compound, promotes regulatory T cell differentiation

Gene Forward (5'-3') Reverse (5'-3')
Mus β-actin GACGGCCAGGTCATCACTATTG AGGAAGGCTGGAAAAGAGCC
Mus Foxp3 (239 T cell) CTACCCACTGCTGGCAAATG GCCTTGCCTTTCTCATCCA
Mus Foxp3 (T cell) CCCAGGAAAGACAGCAACCTT TTCCACAACAAGGCCACTTG
Human 18S GCCCGAAGCGTTTACTTTGA TCCATTATTCCTAGCTGCGGTATC
Human IL-6Rα CATTGCCATTGTTCTGAGGTTC AGTAGTCTGTATTGCTGAGGTTC