Skip to main content

Table 1 Primer sequences used in this study

From: Inhibition by curcumin of multiple sites of the transforming growth factor-beta1 signalling pathway ameliorates the progression of liver fibrosis induced by carbon tetrachloride in rats

Target gene Forward primer (5'-3') Reverse primer (5'-3')
TGFβ1 GTGGCTGAACCAAGGAGACG CAGGTGTTGAGCCCTTTCCAG
CTGF GCCCTAGCTGCCTACCGACT ACAGGCTTGGCAATTTTAGGC
Smad2 TCGGAAAGGGCTGCCACAT AGTCATCCAGAGGCGGCAG
Smad3 AGGGCTTTGAGGCTGTCTACC ACCCGATCCCTTTACTCCCA
Smad7 GGGGGAACGAATTATCTGGC CGCCATCCACTTCCCTTGT
GAPDH AGTGCCAGCCTCGTCTCATAG CGTTGAACTTGCCGTGGGTAG